Course Icon
Natural Science - Year II

Unit 60 Lab: Matching DNA strands

Course Materials are always under revision! Weblecture content may change anytime prior to two weeks before scheduled chat session for content.

SO Icon

Lab for Unit 60


This Unit's Homework Page History Lecture Science Lecture Lab Parents' Notes

Unit 60 Laboratory Activity: DNA Analysis

Goal: Compare modern human DNA with the DNA of primates

Materials

Procedure

  1. Select the Nucleotide Structure Sequences database under "Structure".

  2. Cut and paste each of the following two sequences (one at a time) into the DNA text area on the tool you choose. Be sure to remove new lines or spaces if you have any
    • GTTNNTTATNAAGTAGNGCCCTTATATAAACTATTCTCTGTTCTTTCATG GGGAAGCAGATTTGGGTACACCCAAAGGTATTGACTCACCCATCAACAAC CGCTATGTATTTCGTACATTACTGCCAGCCACCATGAATATTGTACGGTA CCATAAATACTTGACCACCTGTAGTACATAAAAACCCAATCCACATCAAA ACCCCCTCCCCATGCTTACAAGCAAGTACAGCAATCAACCCCCAACTATC ACACATCAACTGCAACTCCAAAGCCACCCCTCACCCACTANGATACCAAA NAAACCTACCCACCCTTAACAGTACATAGCACATAAAGCCATTTACCGTA CATAGCACATTACAGTCAAATCCCTTCTCGTCCCATGGATGACCCCCCTC AGATAGGGGTCCCTTGACCACCATCCCCA

    • NGGNCNNCTTTTNNNATTCTTNCCGATTGGTCCTTTAAAACNCTTGCNCN TNGGGCCCGGGTAANNCTACAACTTCCTNCNTTGGCTACNGTTNNCCNNC NGCTTTCTNTNTCNNACNANACAGTTCGCCTNTTTTCANTNTTTNACGTG CNCNNNAANACNANNCCNNATNTGGTGGGTCCATTCTNGCNACTCTCNNA AATCCCNGTCGNCCTNGGTCTTTNTGNNTCCTCNNTNTTNNCTNCNNNTT CCCCNNGAANCTNNNNNGCNNNNNTCCNCCCTCTNNCNCTNANCTANNGN CCCNCTNTNTCNGCCTTNTANTCCTNCGTATTNTGGCNTTGGCAGNACAN TNCNCTTTANTTNCGNCTCNTNCCNCATCCCCATGNAGNTACCCCCCTCG GTNGGNGGGCTCAGCATGNCNANAAATTGTCATTTNTAAGGTNTTTCCNT CTCCNANTTCCTCGNTATAATTTNNTGTGACCTGGGAGTGTTTTTNTNNT TNCNGGTNTGNNCCNTCTGNNNGNAAATTTTCCCNGCCCCGNNTGNTNTN TTTTTTTGTTCCNCNGNTATACCATCNCCATCCCTTGCTNNGTNTTTNNT TTNTNTTTATATCNTCCTCTTCGTNTTTNTTCCCCTTTGCTCCCNNGGGG GGCCANANNTNTNNCNNNNGATAATTCCTCNGGNTGGNCNCATACNTTTG GTTCCNGCNTTTNTTTGCTCCTCTTCCTANGGGGTTGGGNCCTCNTNTTA TTTCNNTTNCCCTTNNCTNGGTGTTTTCNTTNNCCTCNNGGGGNNCTTTT TTTTCCTCCCNNNCNCTTCANNACCCTTCCTTTCTNCCCNCTCCTTTCCT NTTTTTTTGNNNNTTCTTNCTCCTNCCCCNCTNGTCTTCGTTCTTTTNTT TCTTCCNTCTCCTCTTCTTCN
  3. Leave the program defaults at blastn and start the comparison. It may take several minutes to run.
  4. Record the number of matches at 95% or better with human DNA.

Report

Describe your results: how many sequences did the sample DNA strand match against known human DNA?

Challenge question: How might the results of your investigations be used to support theories of evolution?